par M.K. Scarlett.

S’interroger sur le fait de savoir si le Sras-CoV-2 a été ou pas vraiment « isolé » peut sembler pertinent, d’autant que la généticienne Alexandra Henrion-Caude se pose la même question.

L’article qui suit et les informations qu’il contient rend compte de certains faits qui posent question et qui sont par ailleurs peu débattus. Ces éléments ne suffiront sans doute pas à trancher la question, mais ils offrent, considérés dans leur ensemble, des éléments de réponses possibles, qui ouvrent eux-mêmes sur d’autres questionnements. Le tout étant par ailleurs parfois un peu technique, des explications supplémentaires portant sur des détails particuliers seront apportées au lecteur.

Toutefois, et pour mettre les choses en perspective dans le contexte qui est le nôtre aujourd’hui, à savoir que nous avons affaire à des psychopathes — et à des suiveurs autoritaristes souvent corrompus, au rang desquels se trouvent des scientifiques — qui usent de sophisme pour nous raconter une histoire (celle de leur pseudo-réalité), voici un extrait de l’ouvrage de Josef Pieper, Abus de langage, Abus de pouvoir :

« [les sophistes sont des] maîtres dans l’art de déformer les mots, grassement payés et acclamés par les foules […] capables de faire l’éloge d’une chose mauvaise en la faisant apparaître comme bonne et qui [savent] avec maestria transformer le blanc en noir. [la sophistique est] un danger et une menace qui frappent la vie de l’esprit et celle de la société à toutes les époques. […] les sophistes, doués d’une énorme sensibilité pour les nuances du langage et d’une dose extrême d’intelligence formelle, cultivent le mot, érigent et parfaissent l’usage du mot en art — et […] ce faisant, ils corrompent en même temps le sens et la dignité du mot. [Il est essentiel] de reconnaître que quelque chose peut être magnifiquement fait, représenté, mis en scène, filmé brillamment et cependant être en même temps fondamentalement et essentiellement faux, et pas seulement faux, mais aussi mauvais, inférieur, lamentable, honteux, funeste, vil — et pourtant magnifiquement réalisé ! […] la difficulté à reconnaître les sophistes fait partie du succès de ces derniers. »

On retrouve cet abus de langage au sein d’une mauvaise science devenue religieusement universelle dans laquelle il existe

« un phénomène de « corruption systémique », une entreprise de manipulation généralisée permettant de ne pas avoir besoin de soudoyer un grand nombre de personnes. La manipulation globale permet que des foules d’acteurs de bonne foi y participent en toute ignorance de cause. »

Voici donc la traduction de l’article écrit par Iain Davis sur son site Web In This Together.


Le Covid-19, et les réponses gouvernementales qui ont suivi, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’aucune preuve n’existe pour démontrer qu’un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis prêt à être corrigé. Cependant, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur comité consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les sondes et les amorces génétiques utilisées dans les tests RT-PCR pour identifier le Sras-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire de même.

D-Salud-Discovery indique qu’il n’existe aucun test capable d’identifier le Sras-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du Covid-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel du Covid-19 est une supercherie. De toute évidence, il n’existe aucun fondement scientifique dans aucune des parties de ce récit.

Si ces affirmations sont exactes, nous pouvons déclarer qu’il n’existe pas de preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est celles des ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Note de MKS

Puisque l’auteur parle de parasites, voici quatre articles qui pourraient permettre au lecteur de creuser un peu plus :

Qu’ont-ils identifié exactement ?

L’Organisation mondiale de la santé (OMS) a classifié la maladie Covid-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de Covid-19 le 11 mars 2020.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le Sras-CoV et le Mers-CoV) par un séquençage de nouvelle génération à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus du Sras-CoV-2 est à l’origine du Covid-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau coronavirus 2019-nCov — Rapport de situation n° 1 », ils déclarent que :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 […] Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques. »

Ces deux déclarations de l’OMS suggèrent clairement que le virus Sras-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les villages aux quatre coins du globe. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause le Covid-19.

Pourtant, l’OMS affirme également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir d’« informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du virus dit Sras-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines en épi [ou protéine Spike – NdT] contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Des virologues affirment qu’il n’est pas possible d’« isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes [et donc in vivo, et non in vitro dans lequel il est sorti de son environnement et ne peut par conséquent pas se comporter de la même manière – NdT]. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries — qui sont des organismes vivants. Par contre, ce que les virologues observent dans des cultures cellulaires, ce sont les effets cytopathogènes du virus qui provoquent la mutation et la dégradation des cellules.

Lorsque les chercheurs chinois ont au départ séquencé le génome complet du Sras-CoV-2, ils ont observé un effet cytopathogène dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire simienne immortalisée et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Note de MKS

Une lignée cellulaire immortalisée est une lignée qui a échappé à la senescence cellulaire (par un procédé chimique) et qui peut donc se diviser indéfiniment in vitro. Les cellules Vero sont une lignée cellulaire utilisée pour les cultures cellulaires. Les cellules Vero E6 sont un clone de la souche 76, elle-même découverte en 1968. La lignée de cellules Vero a été isolée et établie à partir de rein de singe vert adulte d’Afrique (Certopithecus aethiops) en mars 1962 par Y. Yasumura et Y. Kawakita à l’université de Chiba au Japon. Source

Au cœur de l’histoire officielle du Sras-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, [qui serait – NdT] capable de combler le fossé entre les espèces, des animaux aux humains. Lorsque des scientifiques du CDC aux États-Unis ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du Sras-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, y compris les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0), et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules simiennes]… Aucun effet cytopathogène n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules simiennes] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le Sras-CoV-2. »

Le CDC n’a observé aucun effet cytopathogène dans les cellules humaines. Ils n’ont trouvé aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Que le Sras-CoV-2 soit un virus humain capable de provoquer une maladie généralisée est loin d’être évident. Il se peut même qu’il n’existe pas physiquement. Ne serait-ce alors rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Note de MKS

Notez que le Sras-CoV-2 imagé ci-dessus posséderait une protéine de surface (Spike) présentant une différence notable par rapport à d’autres coronavirus génétiquement proches. Ou plus exactement, le site de clivage de la protéine Spike du Sras-CoV-2 posséderait un insert (un fragment de peptide en plus) de quatre acides aminées, absent des protéines Spike de Sras-CoV. Source

À propos de l’origine soi-disant zoonotique, Judy Mikovits a déclaré ce qui suit : […] Il n’a pas pu apparaître de façon naturelle. Le virus n’a pas pu passer directement à l’homme depuis une chauve-souris achetée au marché par un individu. Ça ne fonctionne pas ainsi. Il s’agit d’une évolution virale accélérée. S’il s’agissait d’un phénomène naturel, il faudrait jusqu’à 800 ans pour que le virus évolue de cette manière.

Rappelons aussi que le Dr Pekova suggérait dès avril dernier que le séquençage du Sras-CoV-2 « semble plutôt anormal, et qu’une restructuration aussi importante a peu de chances de se produire dans la nature, sans intervention humaine ».

Voyage de découverte

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le premier génome complet du Sras-CoV-2 (MN908947.1). Ce séquençage a été mis à jour à de nombreuses reprises. Toutefois, MN908947.1 fut le premier à avoir décrit le prétendu agent étiologique du Sras-Cov-2, à savoir le Covid-19.

Toutes les revendications, les tests, les traitements, les statistiques, le développement de vaccins et les politiques qui en découlent sont basés sur ce séquençage. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit du Covid-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du Sras-CoV-2 en faisant correspondre des fragments trouvés dans les échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1 % avec les coronavirus Sras (Sras-Cov). Ils ont utilisé l’assemblage de novo et la PCR ciblée, et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6 % au Sras-CoV.

Ils ont dû utiliser un assemblage de novo parce qu’ils n’avaient aucune connaissance préalable de la séquence ou de l’ordre corrects de ces fragments. En clair, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

Note de MKS

L’assemblage de novo est une technique de séquençage d’un génome inconnu. Il nécessite l’assemblage d’un très grand nombre de petites séquences de ce même génome. Il nécessite aussi un génome de référence (s’il en existe un) afin de positionner (par comparaison) les séquences obtenues. L’assemblage de novo nécessite pour reconstituer un génome complet des programmes bioinformatiques de pointe. Source

Avant de poursuivre, il est nécessaire de comprendre le principe du test PCR et l’usage qui en est fait dans le cadre de la « crise-Covid-19 ».

Il s’agit en tout premier lieu d’un procédé d’amplification moléculaire qui mime le processus naturel de synthèse de l’ADN.

La PCR ciblée est une technique de réplication ciblée in vitro — ou encore ACP pour « amplification en chaîne par polymérase ». Le principe consiste à obtenir, à partir d’un échantillon complexe et peu abondant, d’importantes quantités d’un fragment d’ADN spécifique et de longueur définie, dont l’ordre de grandeur à retenir est celui du million de copies en quelques heures, ce qui est généralement suffisant pour une utilisation ultérieure. Source

Pour Kary Mullis, l’inventeur de la technique PCR qui lui a permis de gagner le prix Nobel de chimie en 1993, cet examen était avant tout qualitatif et destiné à répondre à la question : l’élément est là, oui ou non, mais il n’était pas du tout destiné à le quantifier, et donc, certainement pas conçu pour poser un diagnostic :

« C’est un procédé qui est utilisé pour faire beaucoup de choses à partir de quelque chose. Ça ne dit pas si vous êtes malade. Ça ne dit pas que la chose que vous avez contractée va réellement vous nuire… »

Voir aussi l’avis d’Alexandra-Henrion Caude sur le sujet : « Covid-19, gestion sanitaire, tests PCR, vaccins ARN, stress — Interview avec Alexandra Henrion-Caude ».

Ces cycles d’amplification successifs, peuvent aller, voire dépassent 40. Plus on augmente le nombre de cycles, plus on sera certain de trouver plus de quelque chose, et même une très faible charge virale donnera un résultat positif — à quelque chose qui ressemble à un coronavirus, puisque ces tests détectent des particules virales, des séquences génétiques, mais PAS le virus en entier. Selon Bernard La Scola dans une étude publiée dans la revue European Journal of Clinical Microbiology & Infectious Diseases, « il n’est plus possible de cultiver du virus in vitro lorsque le cycle d’amplification dépasse 34 ». Multiplier ces cycles nécessitent en outre de nombreuses étapes complexes et sujettes à des erreurs, des fautes de stérilité et des contaminations.

Un article pré-publié sur le site medRxiv en juillet 2020 en fait la synthèse :

« Aucune culture virale n’a été obtenue à partir d’échantillons […] avec des cycles d’amplification supérieurs à 24 ou 34, indiquent les chercheurs. La possibilité de cultiver du virus décroit lorsque les cycles d’amplification augmentent. »

Par ailleurs, et histoire de rajouter à la confusion, le nombre de cycles n’est pas le même d’un pays l’autre, voire d’un laboratoire à l’autre au sein d’un même pays…

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome déjà connu et publié du coronavirus du Sras (Sras-CoV). Malheureusement, la précision du génome original du coronavirus du Sras n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié cinquante patients atteints du syndrome respiratoire aigu sévère (Sras). Ils ont prélevé des échantillons sur deux de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

À partir du matériel génétique trouvé, ils ont créé trente clones. Tandis qu’ils n’ont pu trouver aucune preuve d’un autre virus connu, ils ont toutefois trouvé dans un seul de ces échantillons clonés des séquences génétiques d’« origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57 % de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggéraient la découverte d’un nouveau virus du Sras-CoV (toute nouvelle découverte étant par ailleurs considérée par les scientifiques comme une ambroisie), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour détecter le nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du Sras, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie. »

Note de MKS

Bien que l’auteur l’aborde partiellement plus loin, il est utile d’expliquer rapidement ce qu’est une « amorce » (et une sonde) dans le langage de la recherche génétique, voyons les quatre étapes du test PCR (après le prélèvement).

  • La première étape est celle de la dénaturation réalisée à une température de 95°C, l’ADN double-brin est séparé en ses deux brins d’ADN constitutifs ;
  • La deuxième étape est celle de l’hybridation lors de laquelle un oligonucléotide (la sonde) s’apparie à la séquence d’ADN qui lui est complémentaire ;
  • La troisième étape est celle de la polymérisation dans laquelle un deuxième oligonucléotide, l’amorce, s’hybride en amont, à quelques paires de bases de distance de la sonde ;
  • La quatrième étape est celle de l’émission de fluorescence qui permet d’éventuellement détecter et quantifier un signal fluorescent à même de prouver la présence de ce qui est recherché.

Pour plus de détails, consultez cet article assez simplifié d’où j’ai tiré ce qui précède, ou celui-ci, bien plus fourni. Selon eurofins, les étapes 1 à 4 sont répétées de 35 à 50 fois. Un must !

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs à ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus Sras-CoV. La question n’a pas été posée.

Ce supposé virus ne présentait qu’une correspondance de séquence de 57 % avec un coronavirus prétendument connu. Les 43 % restants étaient juste « là ». Les données séquencées ont été produites et enregistrées en tant que nouveau génome auprès de la GenBank sous le numéro d’accès AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une séquence correspondant à 79,6 % à AY274119 et l’ont donc qualifiée de nouvelle souche de Sras-CoV (2019-nCoV — finalement rebaptisée Sras-CoV-2). Personne n’avait, à aucun moment de ce processus, produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Ils n’ont rien isolé

Les scientifiques sont très agacés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. La raison en est que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus Sras-CoV-2. Ce dont nous disposons, en revanche, c’est d’un génome complet et, comme nous sommes sur le point de le découvrir, celui-ci n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du Sras-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

Note de MKS

En préambule des réponses retranscrites ci-dessous, les auteurs de l’article stipule ce qui suit :

« Et comme les tests PCR sont calibrés pour les séquences de gènes (dans ce cas-ci les séquences d’ARN car on pense que le Sras-CoV-2 est un virus à ARN), nous devons savoir que ces extraits de gènes font partie du virus recherché. Et pour le savoir, il faut procéder à une isolation et une purification correctes du virus présumé.

C’est pourquoi nous avons demandé aux équipes scientifiques [auteurs] des documents pertinents auxquels il est fait référence dans le contexte du Sras-CoV-2 de prouver si les clichés au microscope électronique présentés dans leurs expériences in vitro montrent des virus purifiés. »

Voici les réponses de ces scientifiques :

Study 1: Leo L. M. Poon; Malik Peiris. « Emergence of a novel human coronavirus threatening human health » Nature Medicine, March 2020
Replying Author: Malik Peiris
Date: May 12, 2020
Answer: « The image is the virus budding from an infected cell. It is not purified virus. » [L’image est le virus bourgeonnant d’une cellule infectée. Ce n’est pas un virus purifié.]

Study 2: Myung-Guk Han et al. « Identification of Coronavirus Isolated from a Patient in Korea with COVID-19 », Osong Public Health and Research Perspectives, February 2020
Replying Author: Myung-Guk Han
Date: May 6, 2020
Answer: « We could not estimate the degree of purification because we do not purify and concentrate the virus cultured in cells. » [Nous n’avons pas pu estimer le degré de purification car nous ne purifions pas et ne concentrons pas le virus cultivé dans les cellules.]

Study 3: Wan Beom Park et al. « Virus Isolation from the First Patient with SARS-CoV-2 in Korea », Journal of Korean Medical Science, February 24, 2020
Replying Author: Wan Beom Park
Date: March 19, 2020
Answer: « We did not obtain an electron micrograph showing the degree of purification. » [Nous n’avons pas obtenu de micrographie électronique montrant le degré de purification.]

Study 4: Na Zhu et al., « A Novel Coronavirus from Patients with Pneumonia in China », 2019, New England Journal of Medicine, February 20, 2020
Replying Author: Wenjie Tan
Date: March 18, 2020
Answer: « [We show] an image of sedimented virus particles, not purified ones. » [[Nous montrons] une image de particules de virus sédimentées, et non pas purifiées.]

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus Sras-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré [le 29 janvier 2020] :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic. »

Ceci explique pourquoi le gouvernement australien a déclaré [le 4 décembre 2020] :

« La fiabilité des tests Covid-19 est incertaine en raison de la base de preuves limitée… Il existe peu de preuves disponibles pour évaluer la précision et l’utilité clinique des tests Covid-19 disponibles. »

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus Covid-19 a été isolé. »

Ils n’ont, à ce jour, pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a présenté aux autorités nationales en charge de la santé publique en Angleterre [PHE en anglais – NdT] une requête en vertu de la loi sur la liberté de l’information. Il leur a demandé de lui fournir leurs dossiers décrivant la façon dont le virus du Sras-COV-2 avait été isolé. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande. »

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande. »

Aux États-Unis, le Panel de diagnostic RT-PCR du Centre de contrôle des maladies (CDC) indique ce qui suit :

« […] Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible […] La détection de l’ARN viral pourrait ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques. »

Dans leur dernière mise à jour du 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de Covid-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le Sras-CoV-2 est présent ou cause le Covid-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons nous contenter d’images de choses dont nous savons qu’elles pourraient être autre chose et de séquences génétiques (qui pourraient être n’importe quoi d’autre) comme autant de preuves concluantes que ce virus, et la maladie qu’il est censé causer, sont réels.

Tester en vain

L’OMS, ainsi que tous les gouvernements, les think-thank, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel du Covid-19, affirment que le Sras-CoV-2 provoque le Covid-19. Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du Sras-CoV-2 a été publié. Il relève du domaine public.

Au sein du génome du Sras-CoV-2, des séquences génétiques clés auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment des quatre suivantes :

  • Le gène de l’ARN polymérase ARN-dépendante (Rd-Rp) — Il permet à l’ARN du Sras-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales malades du Covid-19 ;
  • Le gène S (ORF2) — Cette glycoprotéine forme le pic [Spike – NdT] à la surface du virion du Sras-CoV-2 qui est censé faciliter la liaison du Sras-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée ;
  • Le gène E (ORF1ab) — C’est une petite protéine membranaire utilisée dans l’assemblage du virus ;
  • Le gène N (ORF9a) — Il s’agit du gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre accessible au public des amorces et des sondes RT-PCR utilisées pour tester le Sras-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins anti-sens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral présumé. Au cours de l’amplification, alors que les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est de l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du Sras-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST) [il s’agit d’une méthode de recherche heuristique utilisée en bioinformatique. Le BLAST permet de trouver les régions similaires entre deux ou plusieurs séquences de nucléotides ou d’acides aminés, et de réaliser un alignement de ces régions homologues – NdT]. Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc « BLASTER » [rechercher] les amorces, les sondes et les séquences de gènes cibles qui ont été déclarées dans la recherche du Sras-CoV-2.

Les amorces et les protocoles de sonde de l’OMS pour le génome viral présumé du Sras-CoV-2 sont basés sur les profils des gènes Rd-Rp, ORF1, N et E. N’importe qui peut les soumettre à l’analyse de BLAST et découvrir les résultats.

La séquence nucléotidique vitale Rd-RP, utilisée comme amorce avant, est — ATGAGCTTAGTCCTGTTG. Si nous lançons une recherche nucléotidique sur BLAST, celle-ci est enregistrée comme correspondant à l’isolation complète du Sras-CoV-2 avec une identité de séquence identique à 100 %. De même, la séquence d’amorce du gène E inverse — ATATTGCAGCAGTACGCACACA — révèle la présence de la séquence ORF1ab qui identifie également le Sras-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence Rd-Rp du Sras-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100 %. La recherche sur le ORF1ab (gène E) en trouve 90 avec une identité de séquence de 100 % avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes dont la séquence correspond à 100 % au gène du Sras-CoV-2 E, et 100 microbes dont la séquence correspond à 100 % au gène vital Rd-Rp du Sras-CoV-2 .

Chaque fois que nous vérifions les soi-disant marqueurs génétiques uniques au Sras-CoV-2 qui sont enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le Sras-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, depuis des séquences microbiennes jusqu’à des fragments de chromosomes humains.

Les soi-disant vérificateurs-de-faits (fact-checkers), comme le projet Health Feedback de Reuters, se sont empressés de rejeter les revendications de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du Sras-CoV-2. Ils utilisent une ribambelle d’arguments bidons comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), ce qui fait que leur tentative de démystification aboutit à quelque chose comme ça :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus Sras-CoV-2. De plus, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence d’ADNc entre les amorces est unique au virus. »

Cette façon de faire semble déformer de manière délibérée la portée des observations émises en amont en avançant un argument que personne, à part les vérificateurs-de-faits eux-mêmes, ne fait valoir. Les recherches effectuées sur BLAST montrent que ces séquences cibles ne sont pas uniques au Sras-CoV-2. Pas plus qu’il n’est nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont enquêté sur l’épidémiologie des cas marocains présumés du Sras-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs à aucun.

Ceci est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (TAAN) avec au moins deux cibles indépendantes du génome du Sras-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé […] Un ou plusieurs résultats négatifs n’excluent pas nécessairement une infection par le Sras-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs-de-faits grassement rémunérés, si les amorces avant et arrière identifient des débris, l’une identifiant peut-être le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée située entre elles est probablement aussi un débris.

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que dans le prétendu génome du Sras-CoV-2 l’entièreté des chromosomes ou des microbes sont séquencés. Même s’il est possible que ce soit effectivement le cas, pour ce que l’on en sait. Ce qui est avancé [par ceux qui interroge les méthodes de dépistage – NdT], c’est que les prétendus marqueurs utilisés pour tester ce supposé virus ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des occurrences de fluorescence de sondes spécifiques pour indiquer la présence de séquences supposées exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « poubelle » (ADNc).

Note de MKS

À propos de l’ADN « poubelle », voir cet article du Dr Gaby : « L’ADN « poubelle » viral, le régime cétogène qui améliore l’ADN et les effets cométaires ».

Par exemple, le gène S du Sras-CoV-2 est censé être hautement spécifique au génome du virus du Sras-CoV-2. La séquence cible est — TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100 %. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95 %. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100 % avec 86 fragments de chromosomes humains.

Quel que soit l’endroit où l’on regarde dans le supposé génome du Sras-CoV-2, rien dans les protocoles de test de l’OMS ne permet d’identifier clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du Sras-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas — et puisqu’il n’y a pas d’isolats ou d’échantillons purifiés du virus — aucune preuve de l’existence du Sras-CoV-2 sans test viable ne peut exister. Par conséquent, il n’existe pas non plus de preuve de l’existence d’une maladie appelée Covid-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de Covid-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Note de MKS

Sur rien de « scientifique », mais sur une nécessité psychopathique servie par une certaine science, sans aucun doute.

Fraude et conspiration

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre. »

La définition juridique d’une conspiration est la suivante

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel. »

Il semblerait que ceux qui prétendent que nous sommes confrontés à une pandémie n’aient fourni aucune preuve montrant qu’un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Toutes les informations suggérant fortement qu’une telle probabilité existe sont facilement accessibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations à des fins frauduleuses, il s’agit alors d’une conspiration (dans les pays qui appliquent la Common law) ou d’une entreprise criminelle commune en vertu du Droit international.

Note de MKS

La Common law est système juridique anglo-saxon dont les règles sont principalement édictées par les tribunaux au fur et à mesure des décisions individuelles, et non sur le Droit civil comme en France qui s’appuie sur le Droit codifié — encore que la France fait de plus en plus souvent fi du Droit codifié pour le remplacer par la Common law, dont la jurisprudence a toujours été l’élément fondamental. Généralement, les pays sous la Common law sont les anciennes colonies ou les anciens protectorats britanniques y compris les Etats-Unis (à la seule exception de la Louisiane où s’applique un droit codifié.)

Il semble que le Covid-19 ait été délibérément utilisé comme casus belli pour mener une guerre contre l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de flâner a été restreinte, la liberté de parole et d’expression a été érodée, les droits de manifester ont été réduits, nous avons été séparés de nos proches, et nos sociétés ont été détruites, soumises à des assauts psychologiques, muselées et terrorisées.

Le Prince Charles nous demande d’accueillir la Grande réinitialisation à bras ouverts

Pire encore, alors qu’il n’existe pas de preuve d’une mortalité sans précédent toutes causes confondues, on a enregistré des pics de mortalité anormaux. Ces pics correspondent précisément aux mesures de « confinement » qui ont entraîné une interruption des soins de santé primaires et une réorientation des services de santé publique financés par nos impôts pour traiter à l’exclusion de toutes les autres une prétendue maladie.

En outre, ceux qui ont présenté et fait circuler le récit Covid-19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à leur soi-disant « nouvelle normalité » [ou nouvelle réalité, soit leur pseudo-réalité – NdT], à savoir la transformation complète sans notre consentement de toute notre société, ils exigent que nous nous soumettions à leurs conditions.

Ces mesures comprennent, sans s’y limiter, une surveillance biométrique de chacun, un contrôle et un suivi centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives, jusqu’à celle qui exige clairement que nous renoncions à toute forme de souveraineté sur nos propres corps. Toutes ces mesures constituent les conditions qui prévalent dans l’esclavage.

Il ne fait aucun doute que nos droits ont été bafoués et que nous en avons été dépouillés. Dans les pays qui exercent la Common law, l’innocence est présumée, mais il n’empêche que les preuves d’un préjudice délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, émanent clairement de think tanks mondialistes et d’institutions supranationales, et ont été élaborées bien avant l’émergence de cette soi-disant pandémie.

Dans les pays soumis au Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils faudrait qu’ils puissent prouver que, en dépit de leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le Covid-19 est un mythe.

Note de MKS

Le Code Napoléon est aussi appelé Code civil, et la présomption d’innocence est le principe selon lequel toute personne, qui se voit reprocher une infraction, est réputée innocente tant que sa culpabilité n’a pas été légalement démontrée. La plupart des pays d’Europe reconnaissent et utilisent le principe de la présomption d’innocence selon l’article 6 de la Convention européenne des droits de l’homme. Toutefois, il est des cas, tout du moins en France, où la présomption de culpabilité existe en vertu des exceptions au droit à la présomption d’innocence. Ces exceptions sont légales et la charge de la preuve de la non-culpabilité repose alors sur le prévenu.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source de l’article initialement publié en anglais le 16 novembre 2020 : In This Together

traduit par


Alors, fraude totale ou partielle ?

Si l’on part du principe, comme postulé ici, que le Sras-Cov-2 est d’origine humaine, et qu’il est donc « réel », faut-il donc en déduire que le séquençage qui en a été fait est faux, bidouillé, falsifié, suffisamment pour en cacher certains éléments, parmi ceux qui pourraient servir les psychopathes au pouvoir, mais pas assez pour en révéler certains aspects ? Encore que les éléments de preuve développés dans « Les preuves irréfutables de l’origine humaine du Sras-Cov-2 » proposent justement d’y répondre :

« Nous avons tout au long de cet article examiné les preuves suggérant que le Sras-Cov-2 a été fabriqué à Fort Detrick et qu’il a été incorporé dans un vaccin dans le but explicite de se propager à grande échelle et d’affecter les fonctions neurologiques associées à l’obéissance.

Il semble que ce projet ait toutefois échoué, d’abord parce que le « virus de l’obéissance » a muté en un « virus de la désobéissance », ce qui a contraint les pouvoirs publics à prendre — à tout prix — des mesures hâtives en vue de limiter la propagation du mutant bénéfique.

Le confinement général fut une tentative désespérée de minimiser la propagation des effets potentiellement bénéfiques de la mutation du Sras-Cov-2. »

Au départ, il y a une fabrication. Puis s’en est suivi une mutation. Le séquençage « officiel » du Sras-Cov-2 correspond-il au virus initial ou à sa mutation ? Ou à un autre « état » intermédiaire ?

Quoiqu’il en soit, c’est une question à laquelle il est pour le moment difficile de répondre, et il est possible que nous n’en saurons jamais rien. Nous avons plus que certainement des lacunes tant techniques que factuelles pour comprendre les tenants (mais pas les aboutissants) de tout ceci. Tout ce que nous savons, à ce stade, c’est que ce virus est utilisé pour tenter d’imposer aux populations terrorisées un monde dystopique — par le biais notamment d’un programme économique et politique totalitaire qui se propose d’avancer des conjectures et des théories malsaines sur ce à quoi le monde post-soi-disant-pandémique devrait ressembler.

« Faites-vous vacciner pour protéger les autres ! » « Pas de vaccin = pas de travail, pas de shopping, pas de voyage, pas de socialisation ! ». En gros, vous êtes libre de choisir entre le passeport d’immunité ou une peine de prison à vie dans une cellule isolée.

Pour conclure, qu’est-ce que la « science » ? Selon Nissim Amzallag :

« La science ne distille pas forcément le vrai, cela nous le savons depuis le début du XXe siècle. Et pourtant, une aura d’objectivité continue de protéger la science de toute critique non seulement sur ses fondements, mais encore sur la manière dont elle s’impose pour façonner la société. »

L’auteur dans son ouvrage La réforme du vrai — Enquête sur les sources de la modernité, publié en 2010 aux Éditions Charles Léopold Mayer, « explore les fondements sur lesquels s’est appuyée la révolution scientifique et les métamorphoses qu’elle a induites dans la société. » Nissim Amzallag plonge dans des considérations historiques pour essayer de comprendre si la science naissante, dite moderne depuis la pomme de Newton (mythe fondateur, s’il en est), « fut réellement motivée par un désir sincère d’intelligence du réel ». C’est loin d’être le cas :

« les innovations les plus importantes, conceptuelles comme pratiques, dérivent de parti pris étrangers à toute exigence du réel ».

Son livre s’adresse à tous ceux qui souhaitent s’émanciper « de l’autorité d’une idéologie maquillée en savoir » en prenant conscience de l’existence d’une réforme du vrai. Ou devrait-on l’appeler « réforme du réel » ? En effet, il est difficile, quand on les connaît toutes les deux, de ne pas faire le lien entre l’existence des pseudo-réalités psychopathiques et la réforme du vrai de l’auteur, une réforme qui permet justement la mise en place de la dite pseudo-réalité. Dans son ouvrage, il en aborde en 2010 toutes les étapes sauf celle, finale, mais vouée à l’échec de par sa nature utopique, que nous expérimentons aujourd’hui.

Source :

À propos jeminformetv

JEMINFORMETV.COM, est une chaîne d'information web, consacrée à l'actualité africaine et internationale. JE M’INFORME TV (JMTV ) a été créée en 2017. Documentaires - Reportages - Émissions "UN ŒIL SUR LE WEB" S'INFORMER - S'ABONNER - PARTAGER


Votre commentaire

Entrez vos coordonnées ci-dessous ou cliquez sur une icône pour vous connecter:


Vous commentez à l’aide de votre compte Déconnexion /  Changer )

Photo Google

Vous commentez à l’aide de votre compte Google. Déconnexion /  Changer )

Image Twitter

Vous commentez à l’aide de votre compte Twitter. Déconnexion /  Changer )

Photo Facebook

Vous commentez à l’aide de votre compte Facebook. Déconnexion /  Changer )

Connexion à %s

%d blogueurs aiment cette page :